Top » Catalog » J2 » FGC32507

$18.00

FGC32507
[FGC32507]

FGC32507
hg38 Position: ChrY:14091343..14091343
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2
Comments: Below L25 > FGC9927 > Y14698
Forward Primer: FGC32507_F TTTTCCTTTCATTATTGATACTTCTGTC
Reverse Primer: FGC32507_R AAAGAGACACCCACCTCCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1357
1 x SK1388
1 x Y14380
1 x Y20325
1 x Y13639
1 x A12449
1 x A19147
1 x Y947
1 x FGC32609
1 x Y22063
$180.00
Haplogroup Info
Other products
Currencies