Top » Catalog » J2 » BY140494

$18.00

BY140494
[BY140494]

BY140494
hg38 Position: ChrY:20584668..20584668
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: Below L26
Forward Primer: BY140494_F TTGGTCTACGGGACTATCAGG
Reverse Primer: BY140494_R TGGCCTTTAAATGGATGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16923
1 x FGC16561
1 x FGC30649
1 x J2a-PF5197 Panel
1 x PF5174
1 x FGC35495
1 x Y16934
1 x FGC36482
1 x PF5350
1 x FGC6748
1 x Y9005
1 x Y22037
1 x Y3620
1 x FGC5956
1 x L531
1 x J2-Y12007 Autrata Panel
1 x FGC21080
1 x Y14678
1 x FGC32617
1 x FGC53046
1 x L198
1 x FT83497
1 x Y17066
1 x Y17064
1 x Y15606
$808.00
Haplogroup Info
Other products
Currencies