Top » Catalog » J2 » PF7321

$18.00

PF7321
[PF7321]

PF7321
hg38 Position: ChrY:19695275..19695275
Ancestral: A
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2
Comments: Below M205
Forward Primer: PF7321_F CCAATCTTTTTCAAGGTTTTCC
Reverse Primer: PF7321_R GCTGTGGGTTTTGTATTCTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH1244
1 x FGC30303
1 x Y15178
1 x FGC21085
1 x HU219
$90.00
Haplogroup Info
Other products
Currencies