Top » Catalog » J2 » FT83497

$18.00

FT83497
[FT83497]

FT83497
hg38 Position: ChrY:9935786..9935786
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: FT83497_F GCACTGCATTCTGGTCAATG
Reverse Primer: FT83497_R CAGTGCAGTGGCACAATCTC
Reviews

Customers who bought this product also purchased
Y176088
Y176088
FT83787
FT83787
FT83669
FT83669
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19193
1 x PF5273
1 x PH3120
1 x Y17030
1 x L363
1 x Y21460
1 x PF5060
1 x FGC32607
1 x PH1080
1 x SK1399
1 x SK1340
1 x FGC45340
1 x FGC5879
$234.00
Haplogroup Info
Other products
Currencies