Top » Catalog » J2 » A25163

$18.00

A25163
[A25163]

A25163
hg38 Position: ChrY:19509394..19509394
Ancestral: C
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: Below L25 > L70 > CTS6061 > FGC21085
Forward Primer: A25163_F CTTCATTCCTTTGGACAAGGAC
Reverse Primer: A25163_R GCCAAACAAAAGACAGCAGAAG
Reviews

Customers who bought this product also purchased
A25164
A25164
A25167
A25167
A25166
A25166
A25165
A25165
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y997
1 x FGC5948
1 x FGC5977
1 x Y9406
1 x AMM116
1 x Y13637
$108.00
Haplogroup Info
Other products
Currencies