Top » Catalog » J2 » A25164

$19.00

A25164
[A25164]

A25164
hg38 Position: ChrY:19850833..19850833
Ancestral: G
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: Below L25 > L70 > CTS6061 > FGC21085
Forward Primer: A25164_F GGAGTCTCAATGATTGCTAGCAG
Reverse Primer: A25164_R ATGTCCTCCTGTAGCTCAGAGTG
Reviews

Customers who bought this product also purchased
A25163
A25163
A25167
A25167
A25166
A25166
A25165
A25165
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies