Top » Catalog » J2 » A25166

$18.00

A25166
[A25166]

A25166
hg38 Position: ChrY:21170391..21170391
Ancestral: A
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: Below L25 > L70 > CTS6061 > FGC21085
Forward Primer: A25166_F CAGCATGACCCCCACTTTC
Reverse Primer: A25166_R GCTATAAAGACATATGCACACGTACA
Reviews

Customers who bought this product also purchased
A25165
A25165
A25164
A25164
A25163
A25163
A25167
A25167
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y17054
1 x Y9405
1 x A24024
1 x Y2163
1 x FGC19515
1 x FGC32611
1 x Y20567
1 x J2-BY268-Kessler Panel
1 x CTS6061
1 x A15503
1 x FGC17726
1 x FGC5929
$379.00
Haplogroup Info
Other products
Currencies