Top » Catalog » J2 » FT84003

$18.00

FT84003
[FT84003]

FT84003
hg38 Position: ChrY:19117521..19117521
Ancestral: G
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: FT84003_F ATTTGAATGCCTCTGGTACTGC
Reverse Primer: FT84003_R CTAGCGGAAAGAAAGAAATAACTAAC
Reviews

Customers who bought this product also purchased
FT83405
FT83405
FT83587
FT83587
FT83442
FT83442
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1393
$18.00
Haplogroup Info
Other products
Currencies