Top » Catalog » J2 » Y13511

$18.00

Y13511
[Y13511]

Y13511
hg38 Position: ChrY:8466599..8466599
Ancestral: T
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y13511_F GAGAATGTGACCCTTGTATGCC
Reverse Primer: Y13511_R GTAGGCAGAGAAGAGGAATGTGTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Y9005
Y9005
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21088
1 x SK1326
1 x S5061
1 x A23497
1 x PH878
1 x Y16356
1 x FGC6737
1 x A16360
$144.00
Haplogroup Info
Other products
Currencies