Top » Catalog » J2 » PF831

$18.00

PF831
[PF831]

PF831
hg38 Position: ChrY:15068632..15068632
Ancestral: A
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: PF831_F CTGCATTCCCATATGGCC
Reverse Primer: PF831_R GTGTCCAGATTCAGACACCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15933
1 x PF5119
1 x Y16839
$54.00
Haplogroup Info
Other products
Currencies