Top » Catalog » J2 » FGC30635

$18.00

FGC30635
[FGC30635]

FGC30635
hg38 Position: ChrY:8082614..8082614
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J2a1h2d (not listed)
Comments: Below L25 > Z7700 > SK1382
Forward Primer: FGC30635_F CACATTAACTGGGTGCTGGAC
Reverse Primer: FGC30635_R TTTGCCTCCTGGGAACAG
Reviews

Customers who bought this product also purchased
SK1382
SK1382
FGC9883
FGC9883
Z7700
Z7700
L24
L24
L534
L534
J2-M172 Superclade Panel
J2-M172 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y13616
$18.00
Haplogroup Info
Other products
Currencies