Top » Catalog » J2 » L560

$18.00

L560
[L560]

L560
hg38 Position: ChrY:19737974..19737974
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1b1a
Comments: Found in a hg J-M92* WTY participant
Forward Primer: L560_F TTCTCCTTTCTTGCTTTATGCAG
Reverse Primer: L560_R GGCAGGGAGAGTTCATTGTC
Reviews

Customers who bought this product also purchased
Z6257
Z6257
M67
M67
L26
L26
J2-M172 Superclade Panel
J2-M172 Superclade Panel
Z467
Z467
Y11782
Y11782
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15933
1 x PF5119
1 x Y16839
1 x Y17070
1 x BY45501
1 x ALK659
1 x PH2758
1 x Y15239
1 x FGC16088
1 x Y12907
1 x Y1008
1 x FGC20430
1 x Y14398
1 x L560
1 x HU167
1 x Y15173
1 x Y17061
1 x Y12589
1 x Y15601
$342.00
Haplogroup Info
Other products
Currencies