Top » Catalog » J2 » L560

$18.00

L560
[L560]

L560
hg38 Position: ChrY:19737974..19737974
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1b1a
Comments: Found in a hg J-M92* WTY participant
Forward Primer: L560_F TTCTCCTTTCTTGCTTTATGCAG
Reverse Primer: L560_R GGCAGGGAGAGTTCATTGTC
Reviews

Customers who bought this product also purchased
Z6253
Z6253
ZS6172
ZS6172
Y20492
Y20492
Z6257
Z6257
Z467
Z467
M67
M67
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies