Top » Catalog » J2 » FGC20157

$18.00

FGC20157
[FGC20157]

FGC20157
hg38 Position: ChrY:14530756..14530756
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of M67 > PF5132
Forward Primer: FGC20157_F GCAATGTGGTATTCTTTCATGG
Reverse Primer: FGC20157_R GGGATTGTCAATGCTTTTCC
Reviews

Customers who bought this product also purchased
Z6257
Z6257
Z2227
Z2227
PF5132
PF5132
Z6253
Z6253
PF5197
PF5197
M67
M67
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21088
1 x SK1326
1 x S5061
1 x A23497
1 x PH878
1 x Y16356
1 x FGC6737
1 x A16360
1 x CTS11760
1 x Y16952
1 x FGC30266
1 x M318
1 x PF7415
1 x FGC21094
1 x FGC16628
1 x PH1656
1 x BY45504
1 x Y16998
$324.00
Haplogroup Info
Other products
Currencies