Top » Catalog » J2 » M410

$18.00

M410
[M410]

M410
hg38 Position: ChrY:2883637..2883637
Ancestral: A
Derived: G
Reference: Sengupta et al. 2006
ISOGG Haplogroup: J2a
Comments: .
Forward Primer: M410_F TCATTGACCTTAAGTCTGAGTCCC
Reverse Primer: M410_R ACTGGATACCTTTCTAGGAAGAATTG
Reviews

Customers who bought this product also purchased
Y164257
Y164257
BY114993
BY114993
Z38506
Z38506
DF13
DF13
S6881
S6881
SK1403
SK1403
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19130
1 x FGC64040
1 x Y15195
1 x F4326
1 x Y13640
1 x Y14399
1 x Y15193
1 x SK1327
1 x FGC5931
$162.00
Haplogroup Info
Other products
Currencies