Top » Catalog » J2 » PF5132

$18.00

PF5132
[PF5132]

PF5132
hg38 Position: ChrY:15322481..15322481
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a2a2b1a
Comments: Extracted from genome study of Sardinian samples Downstream M67
Forward Primer: PF5132_F AATCCTGTGACCCGTTGC
Reverse Primer: PF5132_R TACATGGTCCTGCATCTTGC
Reviews

Customers who bought this product also purchased
CTS900
CTS900
Z467
Z467
J2a-M67 Panel
J2a-M67 Panel
Z6270
Z6270
Y16996
Y16996
Z28551
Z28551
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16313
1 x FGC47760
1 x Y14568
1 x Y11782
1 x CTS494
1 x Y15052
1 x L207.1
1 x PF5191
1 x FGC4992
1 x P354
1 x CTS3307
1 x FGC15782
1 x Y14563
1 x Y998
1 x M260
1 x HU225
$288.00
Haplogroup Info
Other products
Currencies