Top » Catalog » J2 » PF5132

$18.00

PF5132
[PF5132]

PF5132
hg38 Position: ChrY:15322481..15322481
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a2a2b1a
Comments: Extracted from genome study of Sardinian samples Downstream M67
Forward Primer: PF5132_F AATCCTGTGACCCGTTGC
Reverse Primer: PF5132_R TACATGGTCCTGCATCTTGC
Reviews

Customers who bought this product also purchased
Z6270
Z6270
Y16996
Y16996
Z28551
Z28551
CTS900
CTS900
Z467
Z467
J2a-M67 Panel
J2a-M67 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies