Top » Catalog » J2 » CTS7683

$18.00

CTS7683
[CTS7683]

CTS7683
hg38 Position: ChrY:15502486..15502486
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Syn. with CTS7683; downstream M410 CTS10036
Forward Primer: CTS7683_F AGCTCTGGGAGAAATGGAATG
Reverse Primer: CTS7683_R ATTCTTCTCATGCCCCCA
Reviews

Customers who bought this product also purchased
PF5000
PF5000
P279
P279
PF5056
PF5056
SK1403
SK1403
PF5050
PF5050
PF5048
PF5048
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16817
1 x BY8213
1 x SK1363
1 x BY5677
1 x F1486
1 x A11832
1 x ALK899
1 x A428
1 x FGC14295
1 x A8794
1 x FGC10411
1 x A19342
1 x PAGES00014
1 x Y12594
1 x Y70908
1 x A24019
1 x FGC7982
1 x A14349
1 x A13633
1 x A8260
$360.00
Haplogroup Info
Other products
Currencies