Top » Catalog » J2 » M12

$18.00

M12
[M12]

M12
hg38 Position: ChrY:7715439..7715439
Ancestral: G
Derived: T
Reference: Underhill et al. 1997
ISOGG Haplogroup: J2b
Comments: DYS260a
Forward Primer: M12_F GGGATCTCACTCTGTTTCTTAGATTGT
Reverse Primer: M12_R CACTGTAAACTTTCCCATATCACTG
Reviews

Customers who bought this product also purchased
Y12618
Y12618
Y16576
Y16576
Y51684
Y51684
Y140389
Y140389
Y27505
Y27505
CTS4371
CTS4371
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies