Top » Catalog » J2 » M12

$18.00

M12
[M12]

M12
hg38 Position: ChrY:7715439..7715439
Ancestral: G
Derived: T
Reference: Underhill et al. 1997
ISOGG Haplogroup: J2b
Comments: DYS260a
Forward Primer: M12_F GGGATCTCACTCTGTTTCTTAGATTGT
Reverse Primer: M12_R CACTGTAAACTTTCCCATATCACTG
Reviews

Customers who bought this product also purchased
Y143905
Y143905
Z534
Z534
M172
M172
Y25815
Y25815
PF5050
PF5050
SK1317
SK1317
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1357
1 x SK1388
1 x Y14380
1 x Y20325
1 x Y13639
1 x A12449
1 x A19147
1 x Y947
1 x FGC32609
1 x Y22063
1 x Y25795
1 x Y16837
1 x Y13685
1 x Y5501
1 x FGC53804
1 x FGC21093
1 x FGC58060
1 x BY188782
1 x Y2151
1 x FGC33279
1 x L26
$378.00
Haplogroup Info
Other products
Currencies