Top » Catalog » J2 » M319

$18.00

M319
[M319]

M319
hg38 Position: ChrY:13355905..13355905
Ancestral: T
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: J2a1d
Comments: .
Forward Primer: M319_F CATTCTTGTCAAATCCTTCAAATC
Reverse Primer: M319_R CATCCTGCAAAGGTTCTGTG
Reviews

Customers who bought this product also purchased
L26
L26
Z6065
Z6065
Y23722
Y23722
J2-M172 Superclade Panel
J2-M172 Superclade Panel
Z2227
Z2227
Y23726
Y23726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC20437
1 x A11793
1 x CTS1225
1 x PF5196
1 x A5360
1 x Y14375
1 x FGC61398
1 x Y13668
1 x S11868
$162.00
Haplogroup Info
Other products
Currencies