Top » Catalog » J2 » M319

$18.00

M319
[M319]

M319
hg38 Position: ChrY:13355905..13355905
Ancestral: T
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: J2a1d
Comments: .
Forward Primer: M319_F CATTCTTGTCAAATCCTTCAAATC
Reverse Primer: M319_R CATCCTGCAAAGGTTCTGTG
Reviews

Customers who bought this product also purchased
Y16826
Y16826
Z39603
Z39603
S18579
S18579
S11868
S11868
S18910
S18910
Z6064
Z6064
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies