Top » Catalog » J2 » PF5000

$18.00

PF5000
[PF5000]

PF5000
hg38 Position: ChrY:7013050..7013050
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5000_F AAGCCTGCAGGTGCATAGAG
Reverse Primer: PF5000_R AGGAAAGGCATGCAGGC
Reviews

Customers who bought this product also purchased
Y164257
Y164257
BY114993
BY114993
Z38506
Z38506
PF7381
PF7381
M304
M304
Y29678
Y29678
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22040
1 x FGC20423
1 x Y7008
1 x Y15174
1 x SK1321
1 x L70
1 x Y25798
1 x Y24698
1 x FGC32603
1 x A25164
1 x PF5048
$198.00
Haplogroup Info
Other products
Currencies