Top » Catalog » J2 » PF5000

$18.00

PF5000
[PF5000]

PF5000
hg38 Position: ChrY:7013050..7013050
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5000_F AAGCCTGCAGGTGCATAGAG
Reverse Primer: PF5000_R AGGAAAGGCATGCAGGC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Y164257
Y164257
BY114993
BY114993
Z38506
Z38506
PF7381
PF7381
M304
M304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies