Top » Catalog » J2 » PF5088

$19.00

PF5088
[PF5088]

PF5088
hg38 Position: ChrY:8239389..8239389
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples. Downstream L26
Forward Primer: PF5088_F TATAACTATCTAAAATTACATAGACATACACATACG
Reverse Primer: PF5088_R CAGATAGTTTCACATTTATAATCTATTCCTATAAAG
Reviews

Customers who bought this product also purchased
PH2758
PH2758
BY72868
BY72868
S25258
S25258
FT400927
FT400927
Z459
Z459
BY65997
BY65997
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies