Top » Catalog » J2 » PF5088

$18.00

PF5088
[PF5088]

PF5088
hg38 Position: ChrY:8239389..8239389
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples. Downstream L26
Forward Primer: PF5088_F TATAACTATCTAAAATTACATAGACATACACATACG
Reverse Primer: PF5088_R CAGATAGTTTCACATTTATAATCTATTCCTATAAAG
Reviews

Customers who bought this product also purchased
PF7415
PF7415
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M304
M304
Y14443
Y14443
P38
P38
Z35789
Z35789
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies