Top » Catalog » J2 » PF7381

$18.00

PF7381
[PF7381]

PF7381
hg38 Position: ChrY:15594122..15594122
Ancestral: A
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a (not listed)
Comments: Extracted from genome study of Sardinian samples. Downsream PF5050
Forward Primer: PF7381_F TTAAATGTTTACCTGACTGACTTTCG
Reverse Primer: PF7381_R GGGGTCAGTCCTAGGTTCG
Reviews

Customers who bought this product also purchased
L26
L26
Y29678
Y29678
M9
M9
J2-M172 Superclade Panel
J2-M172 Superclade Panel
PF5000
PF5000
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY181167
1 x Y2154
1 x A13169
1 x Y17065
1 x FGC20447
1 x A25166
1 x Y12906
$126.00
Haplogroup Info
Other products
Currencies