Top » Catalog » J2 » PF7381

$18.00

PF7381
[PF7381]

PF7381
hg38 Position: ChrY:15594122..15594122
Ancestral: A
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a (not listed)
Comments: Extracted from genome study of Sardinian samples. Downsream PF5050
Forward Primer: PF7381_F TTAAATGTTTACCTGACTGACTTTCG
Reverse Primer: PF7381_R GGGGTCAGTCCTAGGTTCG
Reviews

Customers who bought this product also purchased
Z6049
Z6049
MF10470
MF10470
P279
P279
M410
M410
PF5050
PF5050
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies