Top » Catalog » J2 » PF7384

$18.00

PF7384
[PF7384]

PF7384
hg38 Position: ChrY:14201051..14201051
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF7384_F TAACATCCACCCAGATGCAG
Reverse Primer: PF7384_R CCCTTTCCTTTTTCTTTCCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y17054
1 x Y9405
1 x A24024
1 x Y2163
1 x FGC19515
1 x FGC32611
1 x Y20567
1 x J2-BY268-Kessler Panel
1 x CTS6061
1 x A15503
1 x FGC17726
1 x FGC5929
1 x FGC61396
1 x A19115
1 x BY113818
$433.00
Haplogroup Info
Other products
Currencies