Top » Catalog » J2 » Y7708

$18.00

Y7708
[Y7708]

Y7708
hg38 Position: ChrY:16615949..16615949
Ancestral: C
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: J2a1a (not listed)
Comments: Downstream L26 > PF5088 > PF5125 > Z2227 > Z6065.
Forward Primer: Y7708_F TGGTGAGTGTGGTGTCCAAC
Reverse Primer: Y7708_R GTGGTGATCCAGCATGTGAC
Reviews

Customers who bought this product also purchased
Z7553
Z7553
Z7503
Z7503
FGC15901
FGC15901
Z7532
Z7532
ZS7528
ZS7528
Z2227
Z2227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT69031
1 x Y16821
1 x Y4036
1 x FGC32615
1 x Y15245
$90.00
Haplogroup Info
Other products
Currencies