Top » Catalog » J2 » S19231

$18.00

S19231
[S19231]

S19231
hg38 Position: ChrY:15004402..15004402
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Downstream L26 > PF5088 > Z2222 > PF5197 > PF5172 > PF5169 > PF5174
Forward Primer: S19231_F CAAAGCCTCCCTCATCCAC
Reverse Primer: S19231_R TGGAAGCAAGATTGAAATGATATG
Reviews

Customers who bought this product also purchased
Z7290
Z7290
Z7366
Z7366
L1064
L1064
Z34460
Z34460
L24
L24
PF5177
PF5177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies