Top » Catalog » J2 » S19231

$18.00

S19231
[S19231]

S19231
hg38 Position: ChrY:15004402..15004402
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Downstream L26 > PF5088 > Z2222 > PF5197 > PF5172 > PF5169 > PF5174
Forward Primer: S19231_F CAAAGCCTCCCTCATCCAC
Reverse Primer: S19231_R TGGAAGCAAGATTGAAATGATATG
Reviews

Customers who bought this product also purchased
M67
M67
PF5174
PF5174
L26
L26
PF5172
PF5172
J2-M172 Superclade Panel
J2-M172 Superclade Panel
J2a-PF5197 Panel
J2a-PF5197 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21088
1 x SK1326
1 x S5061
1 x A23497
1 x PH878
1 x Y16356
1 x FGC6737
1 x A16360
1 x CTS11760
1 x Y16952
1 x FGC30266
1 x M318
1 x PF7415
1 x FGC21094
1 x FGC16628
1 x PH1656
1 x BY45504
1 x Y16998
1 x PF5383
1 x Y23161
1 x A13165
$378.00
Haplogroup Info
Other products
Currencies