Top » Catalog » J2 » FGC9883

$18.00

FGC9883
[FGC9883]

FGC9883
hg38 Position: ChrY:13669847..13669847
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1h2 (not listed)
Comments: Downstream L25 > Z7700 > Z7706
Forward Primer: FGC9883_F CTGTTCCAGAAAACAAGCAAAC
Reverse Primer: FGC9883_R AATTGTGTCCAATTCTAAGGTTATG
Reviews

Customers who bought this product also purchased
L24
L24
L534
L534
J2-M172 Superclade Panel
J2-M172 Superclade Panel
FGC30635
FGC30635
L271
L271
SK1382
SK1382
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies