Top » Catalog » J2 » SK1382

$18.00

SK1382
[SK1382]

SK1382
hg38 Position: ChrY:14446064..14446064
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a8*
Comments: Equal or downstream PF5314 Z426
Forward Primer: SK1382_F ATGCTACAGTTCCCCTGGAG
Reverse Primer: SK1382_R TTGCATTTCCTTCAGAGACG
Reviews

Customers who bought this product also purchased
L24
L24
L534
L534
J2-M172 Superclade Panel
J2-M172 Superclade Panel
FGC30635
FGC30635
L271
L271
FGC9883
FGC9883
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15167
1 x Y13630
1 x Y13137
1 x L397
1 x Y16464
1 x A19091
1 x BY54613
1 x FT83442
1 x Y24492
1 x HU169
1 x PF5110
1 x PH3514
1 x PF7402
1 x FGC32689
1 x M2525
$270.00
Haplogroup Info
Other products
Currencies