Top » Catalog » J2 » SK1382

$18.00

SK1382
[SK1382]

SK1382
hg38 Position: ChrY:14446064..14446064
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a8*
Comments: Equal or downstream PF5314 Z426
Forward Primer: SK1382_F ATGCTACAGTTCCCCTGGAG
Reverse Primer: SK1382_R TTGCATTTCCTTCAGAGACG
Reviews

Customers who bought this product also purchased
J2-M172 Superclade Panel
J2-M172 Superclade Panel
FGC30635
FGC30635
L271
L271
FGC9883
FGC9883
Z7700
Z7700
L24
L24
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1377
$18.00
Haplogroup Info
Other products
Currencies