Top » Catalog » J2 » FGC20439

$18.00

FGC20439
[FGC20439]

FGC20439
hg38 Position: ChrY:17340574..17340574
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: FGC20439_F CATAATTTGCATAATGCAGAGGATAC
Reverse Primer: FGC20439_R GTTTATTTGTTTGTTTTGCTTTTTTC
Reviews

Customers who bought this product also purchased
FGC20423
FGC20423
FGC20447
FGC20447
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12499
1 x A13164
1 x A12450
1 x FGC17733
1 x L210
1 x FGC30508
1 x Y9011
1 x Y23722
1 x FGC52116
1 x M67
1 x Y23095
1 x Y8497
1 x Y13647
1 x Y15238
1 x SK1342
1 x Y7708
1 x SK1395
1 x FGC31969
$324.00
Haplogroup Info
Other products
Currencies