Top » Catalog » J2 » FGC20447

$18.00

FGC20447
[FGC20447]

FGC20447
hg38 Position: ChrY:21618820..21618820
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: FGC20447_F GGTTTGGCATATTAATAAGAAAGAGG
Reverse Primer: FGC20447_R TGCATATGTACATATAAATTTATGTAATTTCATAG
Reviews

Customers who bought this product also purchased
FGC20423
FGC20423
FGC20439
FGC20439
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S51
1 x FGC33286
1 x Z3610
1 x FGC5904
$72.00
Haplogroup Info
Other products
Currencies