Top » Catalog » J2 » L26

$18.00

L26
[L26]

L26
hg38 Position: ChrY:20781011..20781011
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1
Comments: .
Forward Primer: L26_F GCATGTGTGTTTTGGTGGAG
Reverse Primer: L26_R TCCTTGAGGGTCAGAGGAAG
Reviews

Customers who bought this product also purchased
Z6064
Z6064
P38
P38
P126
P126
PH1038
PH1038
Y36618
Y36618
Y12602
Y12602
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32683
1 x Y14436
1 x Y20339
1 x L283
1 x PH3882
1 x FGC5911
1 x A11792
1 x A12378
1 x AMM136
1 x SK1378
1 x FGC4977
1 x L192.2
1 x Y13893
$234.00
Haplogroup Info
Other products
Currencies