Top » Catalog » J2 » PF5366

$18.00

PF5366
[PF5366]

PF5366
hg38 Position: ChrY:12227526..12227526
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a2c1b2b
Comments: Derived in a hg J-L229 sample
Forward Primer: PF5366_F TGAGATGTCAATGTGGGAGG
Reverse Primer: PF5366_R TTCTGTCTCTTTTAGGAACACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC20437
1 x A11793
1 x CTS1225
1 x PF5196
1 x A5360
1 x Y14375
1 x FGC61398
1 x Y13668
1 x S11868
$162.00
Haplogroup Info
Other products
Currencies