Top » Catalog » J2 » PF5366

$18.00

PF5366
[PF5366]

PF5366
hg38 Position: ChrY:12227526..12227526
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a2c1b2b
Comments: Derived in a hg J-L229 sample
Forward Primer: PF5366_F TGAGATGTCAATGTGGGAGG
Reverse Primer: PF5366_R TTCTGTCTCTTTTAGGAACACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies