Top » Catalog » J2 » PF5383

$18.00

PF5383
[PF5383]

PF5383
hg38 Position: ChrY:16862947..16862947
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5383v2_F GGTTTTCCAGATATACAGTCATGTTG
Reverse Primer: PF5383v2_R CTCTCTCACCACTCCTATTCAACATAA
Reviews

Customers who bought this product also purchased
FGC5878
FGC5878
FGC5879
FGC5879
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22040
$18.00
Haplogroup Info
Other products
Currencies