Top » Catalog » J2 » FGC16561

$18.00

FGC16561
[FGC16561]

FGC16561
hg38 Position: ChrY:12259555..12259555
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream L25 > Z7700 > FGC9883 > FGC9962 > L363
Forward Primer: FGC16561_F TGCTCAGGGGAAAGGTTC
Reverse Primer: FGC16561_R GATTTCCCTCCTGGAAGAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies