Top » Catalog » J2 » FGC32513

$18.00

FGC32513
[FGC32513]

FGC32513
hg38 Position: ChrY:15924138..15924138
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream L25 > Z7700 > FGC9883 > FGC9962
Forward Primer: FGC32513_F CCGTGTTAGCCAGGTTGG
Reverse Primer: FGC32513_R CAGAGTAAACGCCAATGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies