Top » Catalog » J2 » FGC32513

$18.00

FGC32513
[FGC32513]

FGC32513
hg38 Position: ChrY:15924138..15924138
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream L25 > Z7700 > FGC9883 > FGC9962
Forward Primer: FGC32513_F CCGTGTTAGCCAGGTTGG
Reverse Primer: FGC32513_R CAGAGTAAACGCCAATGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15933
1 x PF5119
1 x Y16839
1 x Y17070
1 x BY45501
1 x ALK659
1 x PH2758
1 x Y15239
1 x FGC16088
1 x Y12907
1 x Y1008
1 x FGC20430
1 x Y14398
1 x L560
1 x HU167
1 x Y15173
1 x Y17061
1 x Y12589
1 x Y15601
1 x L243
1 x J2b-M12 Panel
$448.00
Haplogroup Info
Other products
Currencies