Top » Catalog » J2 » FGC32752

$18.00

FGC32752
[FGC32752]

FGC32752
hg38 Position: ChrY:19925758..19925758
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream L25 > Z7700 > FGC9883 > FGC9962 > FGC32513 > FGC32723
Forward Primer: FGC32752_F AAGATGGGAAAGTGCATTGG
Reverse Primer: FGC32752_R GGTTGCATCACTGTCAGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies