Top » Catalog » J2 » PF5350

$18.00

PF5350
[PF5350]

PF5350
hg38 Position: ChrY:6884579..6884579
Ancestral: G
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream L25 > PF5401
Forward Primer: PF5350_F ACCTACACGTTCTGCCCG
Reverse Primer: PF5350_R GGGTGCCTGAGTTTAGATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies