Top » Catalog » J2 » PH185

$18.00

PH185
[PH185]

PH185
hg38 Position: ChrY:6910384..6910384
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream L25 > L70 > Z2177
Forward Primer: PH185_F AGTCTCCCAGCCTCCTCTTC
Reverse Primer: PH185_R ACAGCCAGCTGAGGGAAAC
Reviews

Customers who bought this product also purchased
FGC52112
FGC52112
Z39282
Z39282
FGC6724
FGC6724
Z421
Z421
FGC24630
FGC24630
Z7700
Z7700
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21088
1 x SK1326
1 x S5061
1 x A23497
1 x PH878
1 x Y16356
1 x FGC6737
1 x A16360
1 x CTS11760
1 x Y16952
1 x FGC30266
1 x M318
1 x PF7415
1 x FGC21094
1 x FGC16628
1 x PH1656
$288.00
Haplogroup Info
Other products
Currencies