Top » Catalog » J2 » PH2838

$18.00

PH2838
[PH2838]

PH2838
hg38 Position: ChrY:15010346..15010346
Ancestral: A
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream L25 > L70
Forward Primer: PH2838_F GAGACAATGATACTGCAACCTCAC
Reverse Primer: PH2838_R CACTGGGGCCTGTCATTG
Reviews

Customers who bought this product also purchased
FGC52112
FGC52112
Z39282
Z39282
FGC6724
FGC6724
Z421
Z421
J2a-L24 Panel
J2a-L24 Panel
PH185
PH185
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22040
1 x FGC20423
1 x Y7008
$54.00
Haplogroup Info
Other products
Currencies