Top » Catalog » J2 » PH2838

$18.00

PH2838
[PH2838]

PH2838
hg38 Position: ChrY:15010346..15010346
Ancestral: A
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream L25 > L70
Forward Primer: PH2838_F GAGACAATGATACTGCAACCTCAC
Reverse Primer: PH2838_R CACTGGGGCCTGTCATTG
Reviews

Customers who bought this product also purchased
FGC52112
FGC52112
Z39282
Z39282
FGC6724
FGC6724
Z421
Z421
L70
L70
M2525
M2525
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies