Top » Catalog » J2 » FGC33111

$18.00

FGC33111
[FGC33111]

FGC33111
hg38 Position: ChrY:11984600..11984600
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: L24(xL25)
Forward Primer: FGC33111_F AACTACTCAGGAGGCTGAGATAATAGG
Reverse Primer: FGC33111_R GTTAATAATTACAAACAGTTTAATAGAGGCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30635
1 x FGC52332
1 x FGC35005
1 x HU203
1 x FGC9962
1 x Y14313
1 x SK1361
1 x L27
1 x M137
1 x Y7292
1 x Y13626
1 x Y16913
1 x A16315
1 x SK1323
1 x Y23457
1 x SK1328
1 x Y22055
$306.00
Haplogroup Info
Other products
Currencies