Top » Catalog » J2 » M7018

$18.00

M7018
[M7018]

M7018
hg38 Position: ChrY:16654829..16654829
Ancestral: A
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: J2a1a1b1a
Comments: Downstream M67. Parallel Z1847
Forward Primer: M7018_F TGTCAAAGCAGACTGTTCTTCTC
Reverse Primer: M7018_R TACTATGCAGCCATAAAAAAGATGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF5132
1 x PF5351
1 x A16352
1 x ALK669
1 x CTS10662
1 x A17950
1 x PF5413
1 x S25258
1 x FGC29946
1 x Y13671
1 x FGC34168
$198.00
Haplogroup Info
Other products
Currencies