Top » Catalog » J2 » FGC5929

$18.00

FGC5929
[FGC5929]

FGC5929
hg38 Position: ChrY:13276973..13276973
Ancestral: G
Derived: A
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Found in a J2-L229 person
Forward Primer: FGC5929_F ACCATCACATTTAAGGGAATCAG
Reverse Primer: FGC5929_R TAACCTTGTTCACCACTTGTACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1357
1 x SK1388
1 x Y14380
1 x Y20325
1 x Y13639
1 x A12449
1 x A19147
1 x Y947
1 x FGC32609
1 x Y22063
$180.00
Haplogroup Info
Other products
Currencies