Top » Catalog » J2 » PF7415

$18.00

PF7415
[PF7415]

PF7415
hg38 Position: ChrY:14257794..14257794
Ancestral: T
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a2a1b1a (not listed)
Comments: Downstream of SK1363 and PF7413
Forward Primer: PF7415_F TTATTTATGTTCCGCTAGAGAATCC
Reverse Primer: PF7415_R GGAGTCTTGCTTTGCCACTG
Reviews

Customers who bought this product also purchased
P38
P38
Z2227
Z2227
M168
M168
PF5088
PF5088
P126
P126
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies