Top » Catalog » J2 » PF7415

$18.00

PF7415
[PF7415]

PF7415
hg38 Position: ChrY:14257794..14257794
Ancestral: T
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a2a1b1a (not listed)
Comments: Downstream of SK1363 and PF7413
Forward Primer: PF7415_F TTATTTATGTTCCGCTAGAGAATCC
Reverse Primer: PF7415_R GGAGTCTTGCTTTGCCACTG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M304
M304
Z6064
Z6064
P38
P38
Z2227
Z2227
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L147.5
1 x FGC32513
1 x Y12619
1 x Y16925
1 x Y13618
1 x L396
1 x Y13894
1 x FGC9927
1 x Y12540
$162.00
Haplogroup Info
Other products
Currencies