Top » Catalog » J2 » FGC24630

$18.00

FGC24630
[FGC24630]

FGC24630
hg38 Position: ChrY:12248796..12248796
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream L25 > L70 > Z2177
Forward Primer: FGC24630v2_F CCTCTATGGATCGGCTCAGATAG
Reverse Primer: FGC24630v2_R TGGTGACCTGGAGAAAAAGC
Reviews

Customers who bought this product also purchased
Z7700
Z7700
L70
L70
FGC32683
FGC32683
J2a-L24 Panel
J2a-L24 Panel
PH185
PH185
Z2177
Z2177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1393
1 x Y3622
$36.00
Haplogroup Info
Other products
Currencies