Top » Catalog » J2 » PF5174

$18.00

PF5174
[PF5174]

PF5174
hg38 Position: ChrY:8663540..8663540
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a1a2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5174_F CAAGTGGCAGTTCTCCAATG
Reverse Primer: PF5174_R TTACCAGGCAAAATGCCAAC
Reviews

Customers who bought this product also purchased
Z34460
Z34460
Z7290
Z7290
Z7366
Z7366
L1064
L1064
L24
L24
PF5177
PF5177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies