Top » Catalog » J2 » FGC9878

$18.00

FGC9878
[FGC9878]

FGC9878
hg38 Position: ChrY:13354161..13354161
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1a2c1b3a1
Comments: Downstream L25 / F3133
Forward Primer: FGC9878_F AGGCAGTGGCAAAGTTCAAG
Reverse Primer: FGC9878_R CCTGTGCAATGGGGCTATC
Reviews

Customers who bought this product also purchased
Z7700
Z7700
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH1751
1 x FGC32584
$36.00
Haplogroup Info
Other products
Currencies