Top » Catalog » J2 » PF7395

$18.00

PF7395
[PF7395]

PF7395
hg38 Position: ChrY:12018379..12018379
Ancestral: C
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1b (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF7395_F CCATGCAGGCTTAGATGGAC
Reverse Primer: PF7395_R CTCTCCCCATACCCAATTTC
Reviews

Customers who bought this product also purchased
CTS11388
CTS11388
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30635
1 x FGC52332
1 x FGC35005
1 x HU203
1 x FGC9962
1 x Y14313
1 x SK1361
1 x L27
1 x M137
1 x Y7292
1 x Y13626
1 x Y16913
1 x A16315
1 x SK1323
1 x Y23457
1 x SK1328
1 x Y22055
$306.00
Haplogroup Info
Other products
Currencies