Top » Catalog » J2 » Y3620

$18.00

Y3620
[Y3620]

Y3620
hg38 Position: ChrY:8640134..8640134
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y3620_F AAAAAGCCACAGTGCACCTC
Reverse Primer: Y3620_R TCAGGATGTCTCCATGTTCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19092
1 x Y16947
1 x SK1368
$54.00
Haplogroup Info
Other products
Currencies