Top » Catalog » J2 » Y3622

$18.00

Y3622
[Y3622]

Y3622
hg38 Position: ChrY:8894956..8894956
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y3622_F GAGACTGAAAGGGGCACATGT
Reverse Primer: Y3622_R AAAGCAGGAGTGGAAGTAAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies