Top » Catalog » J2 » Y3622

$18.00

Y3622
[Y3622]

Y3622
hg38 Position: ChrY:8894956..8894956
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y3622_F GAGACTGAAAGGGGCACATGT
Reverse Primer: Y3622_R AAAGCAGGAGTGGAAGTAAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15933
1 x PF5119
1 x Y16839
1 x Y17070
1 x BY45501
1 x ALK659
1 x PH2758
1 x Y15239
1 x FGC16088
1 x Y12907
$180.00
Haplogroup Info
Other products
Currencies