Top » Catalog » J2 » Y3636

$18.00

Y3636
[Y3636]

Y3636
hg38 Position: ChrY:16545109..16545109
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y3636_F AAATTGCATTCCCCAAACAC
Reverse Primer: Y3636_R GAAAACTCACACTGAACTTGACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies