Top » Catalog » J2 » Y3636

$18.00

Y3636
[Y3636]

Y3636
hg38 Position: ChrY:16545109..16545109
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y3636_F AAATTGCATTCCCCAAACAC
Reverse Primer: Y3636_R GAAAACTCACACTGAACTTGACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15167
1 x Y13630
1 x Y13137
1 x L397
1 x Y16464
1 x A19091
1 x BY54613
1 x FT83442
1 x Y24492
1 x HU169
1 x PF5110
1 x PH3514
1 x PF7402
1 x FGC32689
1 x M2525
$270.00
Haplogroup Info
Other products
Currencies